Which one is the correct product of DNA depen | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(D) The process of transcription involves the synthesis of $RNA$ from a $DNA$ template strand.The $DNA$ template strand is given as: $3'TACATGGCAAATAT

Vedclass · Accepted Answer

$5'AUGUACCGUUUAUAGGUAAGU3'$

Vedclass · Answer

(D) The process of transcription involves the synthesis of $RNA$ from a $DNA$ template strand.The $DNA$ template strand is given as: $3'TACATGGCAAATATCCATTCA5'$.According to the base-pairing rules for $RNA$ synthesis:$A$ (Adenine) in $DNA$ pairs with $U$ (Uracil) in $RNA$.$T$ (Thymine) in $DNA$ pairs with $A$ (Adenine) in $RNA$.$C$ (Cytosine) in $DNA$ pairs with $G$ (Guanine) in $RNA$.$G$ (Guanine) in $DNA$ pairs with $C$ (Cytosine) in $RNA$.Applying these rules to the template $3'TACATGGCAAATATCCATTCA5'$:$T \rightarrow A$$A \rightarrow U$$C \rightarrow G$$A \rightarrow U$$T \rightarrow A$$G \rightarrow C$$G \rightarrow C$$C \rightarrow G$$A \rightarrow U$$A \rightarrow U$$A \rightarrow U$$T \rightarrow A$$A \rightarrow U$$T \rightarrow A$$C \rightarrow G$$C \rightarrow G$$A \rightarrow U$$T \rightarrow A$$T \rightarrow A$$C \rightarrow G$$A \rightarrow U$Thus,the resulting $mRNA$ sequence in the $5' \rightarrow 3'$ direction is: $5'AUGUACCGUUUAUAGGUAAGU3'$.

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

Similar Questions

When a mature $mRNA$ was hybridized to its gene,certain loops were observed. These loops represent:

......... acts as a template.

Write an explanatory note on the transcription unit and the gene.

Transcription is the synthesis of .......

Vedclass Test Series

Exam Paper Generator

Online Exam Module

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?$3'TACATGGCAAATATCCATTCA5'$