If RNA polymerase III is removed from the nuc | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(A) In eukaryotes,there are three main types of $RNA$ polymerases involved in transcription:$1$. $RNA$ polymerase $I$ transcribes $r-RNA$ ($28S, 18S,$

Vedclass · Accepted Answer

$t-RNA$

Vedclass · Answer

(A) In eukaryotes,there are three main types of $RNA$ polymerases involved in transcription:$1$. $RNA$ polymerase $I$ transcribes $r-RNA$ ($28S, 18S,$ and $5.8S$).$2$. $RNA$ polymerase $II$ transcribes the precursor of $m-RNA$,called $hn-RNA$ (heterogeneous nuclear $RNA$).$3$. $RNA$ polymerase $III$ is responsible for the transcription of $t-RNA$,$5S$ $r-RNA$,and $sn-RNA$ (small nuclear $RNA$).Therefore,removing $RNA$ polymerase $III$ will directly affect the synthesis of $t-RNA$.

If $RNA$ polymerase $III$ is removed from the nucleoplasm,which of the following will be affected?

Similar Questions

Provide definitions and explanations for the following terms: Exons,Introns,Capping,and Tailing.

During transcription,the $DNA$ strand which acts as a template is called $A$ strand and it has $B$ polarity.

What will be the sequence of $mRNA$ produced by the following stretch of $DNA$?
$3' ATGCATGCATGCATG 5'$ $TEMPLATE$ $STRAND$
$5' TACGTACGTACGTAC 3'$ $CODING$ $STRAND$

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

Vedclass Test Series

Exam Paper Generator

Online Exam Module