The determination of the template and coding | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(A) In the process of transcription,the $DNA$ double helix consists of two strands. One strand acts as the template strand ($3$' to $5$' polarity) and

Vedclass · Accepted Answer

Promoter

Vedclass · Answer

(A) In the process of transcription,the $DNA$ double helix consists of two strands. One strand acts as the template strand ($3$' to $5$' polarity) and the other as the coding strand ($5$' to $3$' polarity).The polarity of the template strand is determined by the position of the promoter.The promoter is a $DNA$ sequence located at the $5$' end (upstream) of the structural gene.It provides the binding site for $RNA$ polymerase and determines which strand will act as the template for transcription.

The determination of the template and coding strands is defined by the presence of which of the following?

Similar Questions

Where is the $TATA$ box found?

What are the functions of $(i)$ methylated guanosine cap,$(ii)$ poly-$A$ tail in a mature $mRNA$?

If the template strand of $DNA$ is $3'-CTGATAGC-5'$,what will be the sequence of the transcribed $RNA$?

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

What is the location of the terminator in a transcription unit?

Vedclass Test Series

Exam Paper Generator

Online Exam Module