What is the primary role of prokaryotic RNA p | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(D) In prokaryotes, a single type of $RNA$ polymerase is responsible for the transcription of all types of $RNA$ ($mRNA$, $tRNA$, and $rRNA$).This enz

Vedclass · Accepted Answer

All of the above

Vedclass · Answer

(D) In prokaryotes, a single type of $RNA$ polymerase is responsible for the transcription of all types of $RNA$ ($mRNA$, $tRNA$, and $rRNA$).This enzyme follows the three major steps of transcription: $1$. Initiation: The $RNA$ polymerase binds to the promoter region with the help of the sigma ($\sigma$) factor.$2$. Elongation: The enzyme facilitates the polymerization of ribonucleotides to form the $RNA$ chain.$3$. Termination: The enzyme recognizes the terminator sequence and releases the nascent $RNA$ chain with the help of the rho ($\rho$) factor.Since the $RNA$ polymerase is involved in all three stages, the correct answer is $D$.

What is the primary role of prokaryotic $RNA$ polymerase in the process of transcription?

Similar Questions

Which one of the following is the sequence on the corresponding coding strand,if the sequence on the mRNA formed is as follows $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$?

What does $snRNAs$ stand for?

The process by which $DNA$ of the nucleus passes genetic information to $mRNA$ is known as:

Define the following terms: $Cistron$ and $Terminator$.

In which direction does $RNA$ polymerase catalyze polymerization?

Vedclass Test Series

Exam Paper Generator

Online Exam Module