Which one of the following is the sequence on | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(D) In the process of transcription,the coding strand of $DNA$ has the same sequence as the mRNA,except that thymine $(T)$ is present in the $DNA$ ins

Vedclass · Accepted Answer

$5' ATCGATCGATCGATCGATCGATCGATCG 3'$

Vedclass · Answer

(D) In the process of transcription,the coding strand of $DNA$ has the same sequence as the mRNA,except that thymine $(T)$ is present in the $DNA$ instead of uracil $(U)$ in the $RNA$.Given mRNA sequence: $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$By replacing uracil $(U)$ with thymine $(T)$,we obtain the sequence of the coding strand:Coding strand sequence: $5' ATCGATCGATCGATCGATCGATCGATCG 3'$Therefore,the correct option is $D$.

List $I$	List $II$
$A$. $RNA$ polymerase $III$	$I$. snRNPs
$B$. Termination of transcription	$II$. Promoter
$C$. Splicing of exons	$III$. Rho factor
$D$. $TATA$ box	$IV$. snRNAs,tRNA

Which one of the following is the sequence on the corresponding coding strand,if the sequence on the mRNA formed is as follows $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$?

Similar Questions

Which process involves the flow of genetic information from $DNA$ to $RNA$?

Removal of introns and joining of exons in a defined order during transcription is called

Define the following terms: $Cistron$ and $Terminator$.

Match List $I$ with List $II$:

List $I$ List $II$

$A$. $RNA$ polymerase $III$ $I$. snRNPs

$B$. Termination of transcription $II$. Promoter

$C$. Splicing of exons $III$. Rho factor

$D$. $TATA$ box $IV$. snRNAs,tRNA

Choose the correct answer from the options given below:

......... acts as a template.

Vedclass Test Series

Exam Paper Generator

Online Exam Module