Removal of introns and joining of exons in a | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(D) The correct answer is $D$. In eukaryotic cells,the primary transcript (pre-$mRNA$) contains both coding sequences called exons and non-coding sequ

Vedclass · Accepted Answer

splicing

Vedclass · Answer

(D) The correct answer is $D$. In eukaryotic cells,the primary transcript (pre-$mRNA$) contains both coding sequences called exons and non-coding sequences called introns. The process of removing these non-coding introns and joining the coding exons together in a specific order to form a mature $mRNA$ molecule is known as splicing. This process is essential for the production of functional proteins,as introns do not code for amino acids.

Removal of introns and joining of exons in a defined order during transcription is called

Similar Questions

Describe the process of transcription in prokaryotes (bacteria).

What is the process of removing introns and joining exons in a defined order during transcription called?

$A$: Single $DNA$ dependent $DNA$ polymerase catalyses transcription of all types of $RNA$ in all except bacteria.
$R$: Structural genes in bacteria are monocistronic.

$RNA$ polymerase-$I$ transcribes eukaryotic ribosomal $RNA$ which does not consist of: (in $S$ $rRNA$)

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

Vedclass Test Series

Exam Paper Generator

Online Exam Module