RNA polymerase II transcribes which type of R | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(D) In eukaryotes,there are three main types of $RNA$ polymerases involved in transcription:$1$. $RNA$ polymerase $I$ transcribes $r-RNA$ ($28S, 18S,$

Vedclass · Accepted Answer

$hn-RNA$

Vedclass · Answer

(D) In eukaryotes,there are three main types of $RNA$ polymerases involved in transcription:$1$. $RNA$ polymerase $I$ transcribes $r-RNA$ ($28S, 18S,$ and $5.8S$).$2$. $RNA$ polymerase $II$ transcribes the precursor of $m-RNA$,which is known as heterogeneous nuclear $RNA$ $(hn-RNA)$.$3$. $RNA$ polymerase $III$ transcribes $t-RNA$,$5S-rRNA$,and $Sn-RNA$ (small nuclear $RNA$).

$RNA$ polymerase $II$ transcribes which type of $RNA$?

Similar Questions

Which form of $RNA$ is most heterogeneous?

Which one of the following is the sequence on the corresponding coding strand,if the sequence on the mRNA formed is as follows $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$?

During elongation of the polypeptide chain, the sigma factor is

The enzyme involved in transcription is . . . . . . .

What is correct for bacterial transcription?

Vedclass Test Series

Exam Paper Generator

Online Exam Module