Genetic information is transferred from the n | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(B) Genetic information is stored in the $DNA$ within the nucleus. During the process of transcription,this information is copied into $mRNA$ $(messen

Vedclass · Accepted Answer

$RNA$

Vedclass · Answer

(B) Genetic information is stored in the $DNA$ within the nucleus. During the process of transcription,this information is copied into $mRNA$ $(messenger RNA)$. $mRNA$ then exits the nucleus through nuclear pores and enters the cytoplasm,where it serves as a template for protein synthesis (translation). Therefore,$RNA$ is the molecule responsible for transferring genetic information from the nucleus to the cytoplasm.

Genetic information is transferred from the nucleus to the cytoplasm by:

Similar Questions

Which stage of the transcription process is shown in the figure below?

Which one of the following is the sequence on the corresponding coding strand,if the sequence on the mRNA formed is as follows $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$?

Which process is represented in the given figure?

In the given transcription unit,identify the regions $I$ and $II$ respectively.

The main enzyme for transcription is .....

Vedclass Test Series

Exam Paper Generator

Online Exam Module