Heterogeneous nuclear RNA (hnRNA) is characte | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(D) In eukaryotes,the primary transcript produced by $RNA$ polymerase $II$ is known as heterogeneous nuclear $RNA$ $(hnRNA)$.$hnRNA$ is a precursor to

Vedclass · Accepted Answer

Has about $200$ or more nucleotides

Vedclass · Answer

(D) In eukaryotes,the primary transcript produced by $RNA$ polymerase $II$ is known as heterogeneous nuclear $RNA$ $(hnRNA)$.$hnRNA$ is a precursor to messenger $RNA$ $(mRNA)$.It is significantly longer than the mature $mRNA$ because it contains both exons (coding sequences) and introns (non-coding sequences).Typically,$hnRNA$ molecules are large,often containing $200$ or more nucleotides,and undergo processing such as splicing,capping,and tailing to become functional $mRNA$.

Heterogeneous nuclear $RNA$ $(hnRNA)$ is characterized by which of the following?

Similar Questions

Prokaryotic transcription mechanism requires the involvement of only one polymerase type and:
$(a)$ It occurs in the cytoplasm only.
$(b)$ It is often coupled with translation.
$(c)$ It does not require splicing but capping is essential.

The molecular basis of cell differentiation depends on the regulation of:

Where is the transcription unit found?

Which of the following is $NOT$ a function of $RNA$ polymerase?

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

Vedclass Test Series

Exam Paper Generator

Online Exam Module