Identify the INCORRECT statement with referen | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(C) In a transcription unit,the $DNA$ strand with polarity $3' \rightarrow 5'$ acts as the template strand,and the strand with $5' \rightarrow 3'$ pol

Vedclass · Accepted Answer

The transcribed $RNA$ is similar to the antisense strand of $DNA$ except it has Uracil base in place of Thymine.

Vedclass · Answer

(C) In a transcription unit,the $DNA$ strand with polarity $3' \rightarrow 5'$ acts as the template strand,and the strand with $5' \rightarrow 3'$ polarity acts as the coding strand.Option $A$ is correct: The promoter is located at the $5'$ end of the structural gene (upstream).Option $B$ is correct: $DNA$ dependent $RNA$ polymerase catalyzes polymerization only in the $5' \rightarrow 3'$ direction.Option $C$ is incorrect: The transcribed $RNA$ is complementary to the template strand (antisense strand) and identical to the coding strand (sense strand),except for the presence of Uracil instead of Thymine. It is not similar to the antisense strand.Option $D$ is correct: The terminator is located at the $3'$ end of the coding strand (downstream).

Identify the $INCORRECT$ statement with reference to transcription unit.

Similar Questions

In eukaryotes,$\text{RNA}$ polymerase-$I$ is responsible for the synthesis of:

What is the process by which genetic information is transferred from $DNA$ to $RNA$?

In eukaryotes,the $mRNA$ that is initially transcribed is called:

The part of the gene that is transcribed but not translated is known as .....

Which one of the following is the sequence on the corresponding coding strand,if the sequence on the mRNA formed is as follows $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$?

Vedclass Test Series

Exam Paper Generator

Online Exam Module