In the process of transcription, the sigma fa | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(A) In prokaryotic transcription, the $RNA$ polymerase enzyme consists of a core enzyme and a sigma factor $(\sigma)$.The core enzyme is responsible f

Vedclass · Accepted Answer

Initiation

Vedclass · Answer

(A) In prokaryotic transcription, the $RNA$ polymerase enzyme consists of a core enzyme and a sigma factor $(\sigma)$.The core enzyme is responsible for the elongation of the $RNA$ chain.The sigma factor $(\sigma)$ specifically recognizes the promoter region on the $DNA$ template.By binding to the promoter, the sigma factor facilitates the initiation of transcription.Once initiation is complete, the sigma factor dissociates from the core enzyme, allowing elongation to proceed.

In the process of transcription, the sigma factor is important for:

Similar Questions

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

Where does $RNA$ polymerase bind to $DNA$?

Which stage of the transcription process is shown in the figure below?

What is the sequence of mRNA if the sequence of the coding strand in a transcription unit is written as $5'-ATGCATGCA-3'$?

What does $X$ represent in the following diagram?

Vedclass Test Series

Exam Paper Generator

Online Exam Module